SARS-CoV-2 Genomic Variants and Their Relationship with the Expressional and Genomic Profile of Angiotensin-Converting Enzyme 2 (ACE2) and Transmembrane Serine Protease 2 (TMPRSS2)
Abstract
:1. Introduction
1.1. SARS-CoV-2
1.2. ACE2 and TMPRSS2
2. Materials and Methods
2.1. Clinical Samples
2.2. Isolation of Nucleic Acids
2.3. RT-qPCR and Absolute Quantification
2.4. PCR of SNPs Research Regions
2.5. Genomic Sequencing
2.6. Statistical Analysis
3. Results
3.1. SARS-CoV-2 Genomic Sequencing
3.2. ACE2 Expression When Infected with Different SARS-CoV-2 Variants
3.3. TMPRSS2 Expression When Infected with Different SARS-CoV-2 Variants
3.4. ACE2 and TMPRSS2 SNPs When Exposed to SARS-CoV-2 Variants
3.5. ACE2 and TMPRSS2 Expression in Health Professionals
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gasmi, A.; Tippairote, T.; Kumar Mujawdiya, P.; Gasmi Benahmed, A.; Menzel, A.; Dadar, M.; Bjørklund, G. Neurological Involvements of SARS-CoV2 Infection. BBI-Health 2021, 5, 944–949. [Google Scholar] [CrossRef] [PubMed]
- Wu, A.; Peng, Y.; Huang, B.; Ding, X.; Wang, X.; Niu, P.; Meng, J.; Zhu, Z.; Zhang, Z.; Wang, J.; et al. Genome Composition and Divergence of the Novel Coronavirus (2019-NCoV) Originating in China. Cell Host Microbe 2020, 27, 325–328. [Google Scholar] [CrossRef] [PubMed]
- Brant, A.C.; Tian, W.; Majerciak, V.; Yang, W.; Zheng, Z.M. SARS-CoV-2: From Its Discovery to Genome Structure, Transcription, and Replication. Cell Biosci. 2021, 11, 136. [Google Scholar] [CrossRef] [PubMed]
- Laue, M.; Kauter, A.; Hoffmann, T.; Möller, L.; Michel, J.; Nitsche, A. Morphometry of SARS-CoV and SARS-CoV-2 Particles in Ultrathin Plastic Sections of Infected Vero Cell Cultures. Sci. Rep. 2021, 11, 3515. [Google Scholar] [CrossRef] [PubMed]
- Benetti, E.; Tita, R.; Spiga, O.; Ciolfi, A.; Birolo, G.; Bruselles, A.; Doddato, G.; Giliberti, A.; Marconi, C.; Musacchia, F.; et al. ACE2 Gene Variants May Underlie Interindividual Variability and Susceptibility to COVID-19 in the Italian Population. Eur. J. Hum. Genet. 2020, 28, 1602–1614. [Google Scholar] [CrossRef]
- Lieberman, N.A.P.; Peddu, V.; Xie, H.; Shrestha, L.; Huang, M.L.; Mears, M.C.; Cajimat, M.N.; Bente, D.A.; Shi, P.Y.; Bovier, F.; et al. In Vivo Antiviral Host Transcriptional Response to SARS-CoV-2 by Viral Load, Sex, and Age. PLoS Biol. 2020, 18, e3000849. [Google Scholar] [CrossRef]
- V’kovski, P.; Kratzel, A.; Steiner, S.; Stalder, H.; Thiel, V. Coronavirus Biology and Replication: Implications for SARS-CoV-2. Nat. Rev. Microbiol. 2021, 19, 155–170. [Google Scholar] [CrossRef]
- Beyerstedt, S.; Casaro, E.B.; Rangel, É.B. COVID-19: Angiotensin-Converting Enzyme 2 (ACE2) Expression and Tissue Susceptibility to SARS-CoV-2 Infection. Eur. J. Clin. Microbiol. Infect. Dis. 2021, 40, 905–919. [Google Scholar] [CrossRef]
- Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Krüger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280. [Google Scholar] [CrossRef]
- Domingo, E.; Escarmís, C.; Lázaro, E.; Manrubia, S.C. Quasispecies Dynamics and RNA Virus Extinction. Virus Res. 2005, 107, 129–139. [Google Scholar] [CrossRef]
- Tracking SARS-CoV-2 Variants—WHO. Available online: https://www.who.int/activities/tracking-SARS-CoV-2-variants (accessed on 10 October 2024).
- Carabelli, A.M.; Peacock, T.P.; Thorne, L.G.; Harvey, W.T.; Hughes, J.; de Silva, T.I.; Peacock, S.J.; Barclay, W.S.; de Silva, T.I.; Towers, G.J.; et al. SARS-CoV-2 Variant Biology: Immune Escape, Transmission and Fitness. Nat. Rev. Microbiol. 2023, 21, 162–177. [Google Scholar] [CrossRef] [PubMed]
- Alcantara, L.C.J.; Nogueira, E.; Shuab, G.; Tosta, S.; Fristch, H.; Pimentel, V.; Souza-Neto, J.A.; Coutinho, L.L.; Fukumasu, H.; Sampaio, S.C.; et al. SARS-CoV-2 Epidemic in Brazil: How the Displacement of Variants Has Driven Distinct Epidemic Waves. Virus Res. 2022, 315, 198785. [Google Scholar] [CrossRef] [PubMed]
- Muñoz-Durango, N.; Fuentes, C.A.; Castillo, A.E.; González-Gómez, L.M.; Vecchiola, A.; Fardella, C.E.; Kalergis, A.M. Role of the Renin-Angiotensin-Aldosterone System beyond Blood Pressure Regulation: Molecular and Cellular Mechanisms Involved in End-Organ Damage during Arterial Hypertension. Int. J. Mol. Sci. 2016, 17, 797. [Google Scholar] [CrossRef] [PubMed]
- Patel, S.; Rauf, A.; Khan, H.; Abu-Izneid, T. Renin-Angiotensin-Aldosterone (RAAS): The Ubiquitous System for Homeostasis and Pathologies. Biomed. Pharmacother. 2017, 94, 317–325. [Google Scholar] [CrossRef] [PubMed]
- Ni, W.; Yang, X.; Yang, D.; Bao, J.; Li, R.; Xiao, Y.; Hou, C.; Wang, H.; Liu, J.; Yang, D.; et al. Role of Angiotensin-Converting Enzyme 2 (ACE2) in COVID-19. Crit. Care 2020, 24, 422. [Google Scholar] [CrossRef]
- Antalis, T.M.; Bugge, T.H.; Wu, Q. Membrane-Anchored Serine Proteases in Health and Disease. PMBTS 2011, 9, 1–50. [Google Scholar]
- Jackson, C.B.; Farzan, M.; Chen, B.; Choe, H. Mechanisms of SARS-CoV-2 Entry into Cells. Nat. Rev. Mol. Cell Biol. 2022, 23, 3–20. [Google Scholar] [CrossRef]
- Meng, B.; Abdullahi, A.; Ferreira, I.A.T.M.; Goonawardane, N.; Saito, A.; Kimura, I.; Yamasoba, D.; Gerber, P.P.; Fatihi, S.; Rathore, S.; et al. Altered TMPRSS2 Usage by SARS-CoV-2 Omicron Impacts Infectivity and Fusogenicity. Nature 2022, 603, 706–714. [Google Scholar] [CrossRef]
- Zhao, H.; Lu, L.; Peng, Z.; Chen, L.L.; Meng, X.; Zhang, C.; Ip, J.D.; Chan, W.M.; Chu, A.W.H.; Chan, K.H.; et al. SARS-CoV-2 Omicron Variant Shows Less Efficient Replication and Fusion Activity When Compared with Delta Variant in TMPRSS2-Expressed Cells. Emerg. Microbes Infect. 2022, 11, 277–283. [Google Scholar] [CrossRef]
- Rossi, Á.D.; Locke, J.; Araújo, F.D.; Almeida, T.B.D.; Leitão, I.D.C.; Ferreira, S.N.; Oliveira, S.; Ávila, R.E.D.; Resende, G.G.; Teixeira, M.M.; et al. Association between ACE2 and TMPRSS2 Nasopharyngeal Expression and COVID-19 Respiratory Distress. Sci. Rep. 2021, 11, 9658. [Google Scholar] [CrossRef]
- Alimoradi, N.; Sharqi, M.; Firouzabadi, D.; Sadeghi, M.M.; Moezzi, M.I.; Firouzabadi, N. SNPs of ACE1 (Rs4343) and ACE2 (Rs2285666) Genes Are Linked to SARS-CoV-2 Infection but Not with the Severity of Disease. Virol. J. 2022, 19, 48. [Google Scholar] [CrossRef] [PubMed]
- Bierhals, N.D.; Knod, E.B.; Weber, A.F.; Valim, A.R.d.M.; Possuelo, L.G.; Renner, J.D.P. Caracterização Genética, Clínica e Epidemiológica de Pacientes Com COVID-19 Em Uma Região Do Sul Do Brasil. Saúde Pesqui. 2022, 15, 1–11. [Google Scholar] [CrossRef]
- Schönfelder, K.; Breuckmann, K.; Elsner, C.; Dittmer, U.; Fistera, D.; Herbstreit, F.; Risse, J.; Schmidt, K.; Sutharsan, S.; Taube, C.; et al. Transmembrane Serine Protease 2 Polymorphisms and Susceptibility to Severe Acute Respiratory Syndrome Coronavirus Type 2 Infection: A German Case-Control Study. Front. Genet. 2021, 12, 667231. [Google Scholar] [CrossRef] [PubMed]
- Amirouche, A.; Ait-Ali, D.; Nouri, H.; Boudrahme-Hannou, L.; Tliba, S.; Ghidouche, A.; Bitam, I. TRIzol-Based RNA Extraction for Detection Protocol for SARS-CoV-2 of Coronavirus Disease 2019. New Microbes New Infect. 2021, 41, 100874. [Google Scholar] [CrossRef] [PubMed]
- Grisard, H.B.d.S.; Schörner, M.A.; Barazzetti, F.H.; Wachter, J.K.; Valmorbida, M.; Wagner, G.; Fongaro, G.; Bazzo, M.L. ACE2 and TMPRSS2 Expression in Patients before, during, and after SARS-CoV-2 Infection. Front. Cell Infect. Microbiol. 2024, 14, 1355809. [Google Scholar] [CrossRef]
- Padilha, D.A.; Filho, V.B.; Moreira, R.S.; Soratto, T.A.T.; Maia, G.A.; Christoff, A.P.; Barazzetti, F.H.; Schörner, M.A.; Ferrari, F.L.; Martins, C.L.; et al. Emergence of Two Distinct SARS-CoV-2 Gamma Variants and the Rapid Spread of P.1-like-II SARS-CoV-2 during the Second Wave of COVID-19 in Santa Catarina, Southern Brazil. Viruses 2022, 14, 695. [Google Scholar] [CrossRef]
- Han, P.; Li, L.; Liu, S.; Wang, Q.; Zhang, D.; Xu, Z.; Han, P.; Li, X.; Peng, Q.; Su, C.; et al. Receptor Binding and Complex Structures of Human ACE2 to Spike RBD from Omicron and Delta SARS-CoV-2. Cell 2022, 185, 630–640. [Google Scholar] [CrossRef]
- Zhang, X.; Wu, S.; Wu, B.; Yang, Q.; Chen, A.; Li, Y.; Zhang, Y.; Pan, T.; Zhang, H.; He, X. SARS-CoV-2 Omicron Strain Exhibits Potent Capabilities for Immune Evasion and Viral Entrance. Signal Transduct. Target. Ther. 2021, 6, 430. [Google Scholar] [CrossRef]
- Barton, M.I.; MacGowan, S.A.; Kutuzov, M.A.; Dushek, O.; John Barton, G.; Anton van der Merwe, P. Effects of Common Mutations in the SARS-CoV-2 Spike RBD and Its Ligand, the Human ACE2 Receptor on Binding Affinity and Kinetics. Elife 2021, 10, e70658. [Google Scholar] [CrossRef]
- Vieira, D.F.B.; Bandeira, D.M.; da Silva, M.A.N.; de Almeida, A.L.T.; Araújo, M.; Machado, A.B.; Tort, L.F.L.; Nacife, V.P.; Siqueira, M.M.; Motta, F.C.; et al. Comparative Analysis of SARS-CoV-2 Variants Alpha (B.1.1.7), Gamma (P.1), Zeta (P.2) and Delta (B.1.617.2) in Vero-E6 Cells: Ultrastructural Characterization of Cytopathology and Replication Kinetics. Braz. J. Infect. Dis. 2024, 28, 103706. [Google Scholar] [CrossRef]
- Malvankar, S.; Singh, A.; Ravi Kumar, Y.S.; Sahu, S.; Shah, M.; Murghai, Y.; Seervi, M.; Srivastava, R.K.; Verma, B. Modulation of Various Host Cellular Machinery during COVID-19 Infection. Rev. Med. Virol. 2023, 33, e2481. [Google Scholar] [CrossRef] [PubMed]
- Clinckemalie, L.; Spans, L.; Dubois, V.; Laurent, M.; Helsen, C.; Joniau, S.; Claessens, F. Androgen Regulation of the TMPRSS2 Gene and the Effect of a SNP in an Androgen Response Element. Mol. Endocrinol. 2013, 27, 2028–2040. [Google Scholar] [CrossRef]
- Katsumura, K.R.; Ong, I.M.; DeVilbiss, A.W.; Sanalkumar, R.; Bresnick, E.H. GATA Factor-Dependent Positive-Feedback Circuit in Acute Myeloid Leukemia Cells. Cell Rep. 2016, 16, 2428–2441. [Google Scholar] [CrossRef] [PubMed]
- Cioccarelli, C.; Sánchez-Rodríguez, R.; Angioni, R.; Venegas, F.C.; Bertoldi, N.; Munari, F.; Cattelan, A.; Molon, B.; Viola, A. IL1β Promotes TMPRSS2 Expression and SARS-CoV-2 Cell Entry Through the P38 MAPK-GATA2 Axis. Front. Immunol. 2021, 12, 781352. [Google Scholar] [CrossRef] [PubMed]
- Korobova, Z.R.; Arsentieva, N.A.; Liubimova, N.E.; Batsunov, O.K.; Dedkov, V.G.; Gladkikh, A.S.; Sharova, A.A.; Adish, Z.; Chernykh, E.I.; Kaschenko, V.A.; et al. Cytokine Profiling in Different SARS-CoV-2 Genetic Variants. Int. J. Mol. Sci. 2022, 23, 14146. [Google Scholar] [CrossRef] [PubMed]
- Hu, B.; Chan, J.F.W.; Liu, H.; Liu, Y.; Chai, Y.; Shi, J.; Shuai, H.; Hou, Y.; Huang, X.; Yuen, T.T.T.; et al. Spike Mutations Contributing to the Altered Entry Preference of SARS-CoV-2 Omicron BA.1 and BA.2. Emerg. Microbes Infect. 2022, 11, 2275–2287. [Google Scholar] [CrossRef]
- Sheikhian, F.; Sadeghi Mofrad, S.; Tarashi, S.; Ghazanfari Jajin, M.; Sakhaee, F.; Ahmadi, I.; Anvari, E.; Sheikhpour, M.; Fateh, A. The Impact of ACE2 Polymorphisms (Rs1978124, Rs2285666, and Rs2074192) and ACE1 Rs1799752 in the Mortality Rate of COVID-19 in Different SARS-CoV-2 Variants. Hum. Genomics 2023, 17, 54. [Google Scholar] [CrossRef]
- Padilha, D.A.; Souza, D.S.M.; Kawagoe, E.K.; Filho, V.B.; Amorim, A.N.; Barazzetti, F.H.; Schörner, M.A.; Fernandes, S.B.; Coelho, B.K.; Rovaris, D.B.; et al. Genomic Surveillance of SARS-CoV-2 in Healthcare Workers: A Critical Sentinel Group for Monitoring the SARS-CoV-2 Variant Shift. Viruses 2023, 15, 984. [Google Scholar] [CrossRef]
- Angeli, F.; Reboldi, G.; Trapasso, M.; Zappa, M.; Spanevello, A.; Verdecchia, P. COVID-19, Vaccines and Deficiency of ACE2 and Other Angiotensinases. Closing the Loop on the “Spike Effect”. Eur. J. Intern. Med. 2022, 103, 23–28. [Google Scholar] [CrossRef]
- Rader, B.; White, L.F.; Burns, M.R.; Chen, J.; Brilliant, J.; Cohen, J.; Shaman, J.; Brilliant, L.; Kraemer, M.U.G.; Hawkins, J.B.; et al. Mask-Wearing and Control of SARS-CoV-2 Transmission in the USA: A Cross-Sectional Study. Lancet Digit. Health 2021, 3, e148–e157. [Google Scholar] [CrossRef]
SNP | Forward Primer | Reverse Primer | Target Gene | Reference Article |
---|---|---|---|---|
rs2285666 | TTCTCCCTGCTCCTATACTACCG | TTCATTCATGTCCTTGCCCTTA | ACE2 | [22] |
rs4646116 | ACCGGTTTTGATTTGGCCAT | CCCTTTTCAGTTTCACGGGC | ACE2 | [23] |
rs2070788 | GAAGTGCTTAGTGGCAGGCA | AGTTTCTGCTGATGAGGAGCC | TMPRSS2 | [24] |
rs383510 | ATGGCTGTGCTTGGGAAATAAC | CTTATTTCCTGGCCGGACGC | TMPRSS2 | [24] |
SNP | B.1.1.28 | Zeta | Gamma | Omicron |
---|---|---|---|---|
rs2285666 | 13% | 33% | 39% | 38% |
rs4646116 | - | - | - | 1.4% |
rs2070788 | 83% | 70% | 79% | 86% |
rs383510 | 83% | 89% | 82% | 81% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Grisard, H.B.d.S.; Schörner, M.A.; Barazzetti, F.H.; Wachter, J.K.; Filho, V.B.; Martinez, R.E.G.; Venturi, C.M.; Fongaro, G.; Bazzo, M.L.; Wagner, G. SARS-CoV-2 Genomic Variants and Their Relationship with the Expressional and Genomic Profile of Angiotensin-Converting Enzyme 2 (ACE2) and Transmembrane Serine Protease 2 (TMPRSS2). Microorganisms 2024, 12, 2312. https://doi.org/10.3390/microorganisms12112312
Grisard HBdS, Schörner MA, Barazzetti FH, Wachter JK, Filho VB, Martinez REG, Venturi CM, Fongaro G, Bazzo ML, Wagner G. SARS-CoV-2 Genomic Variants and Their Relationship with the Expressional and Genomic Profile of Angiotensin-Converting Enzyme 2 (ACE2) and Transmembrane Serine Protease 2 (TMPRSS2). Microorganisms. 2024; 12(11):2312. https://doi.org/10.3390/microorganisms12112312
Chicago/Turabian StyleGrisard, Henrique Borges da Silva, Marcos André Schörner, Fernando Hartmann Barazzetti, Julia Kinetz Wachter, Vilmar Benetti Filho, Rafael Emmanuel Godoy Martinez, Christinni Machado Venturi, Gislaine Fongaro, Maria Luiza Bazzo, and Glauber Wagner. 2024. "SARS-CoV-2 Genomic Variants and Their Relationship with the Expressional and Genomic Profile of Angiotensin-Converting Enzyme 2 (ACE2) and Transmembrane Serine Protease 2 (TMPRSS2)" Microorganisms 12, no. 11: 2312. https://doi.org/10.3390/microorganisms12112312
APA StyleGrisard, H. B. d. S., Schörner, M. A., Barazzetti, F. H., Wachter, J. K., Filho, V. B., Martinez, R. E. G., Venturi, C. M., Fongaro, G., Bazzo, M. L., & Wagner, G. (2024). SARS-CoV-2 Genomic Variants and Their Relationship with the Expressional and Genomic Profile of Angiotensin-Converting Enzyme 2 (ACE2) and Transmembrane Serine Protease 2 (TMPRSS2). Microorganisms, 12(11), 2312. https://doi.org/10.3390/microorganisms12112312